Relay Reggie Crypto Game Dog - Mix of Border Collie, Pug, Husky, Maltese, German Shepard, Grey Wolf, Labrador and Yorkshire Terrier
Relay Reggie
  • Purity 4%
  • Age 9 months
  • Racing Exp 0
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

How do you do? I'm Relay Reggie. My 'G' spot is under my chin...scratch me there and I'll growl softly. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! You know the worst? Watching my humans 'get it on' and I have to lick myself.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCTACGAATCACCCGAAACATACCCAACATTA
A
C
C
T
A
C
G
A
A
T
C
A
C
C
C
G
A
A
A
C
A
T
A
C
C
C
A
A
C
A
T
T
A
Genes: KJ27L24J54F

Composition

Border Collie
18%
Pug
18%
Husky
18%
Maltese
9%
German Shepard
9%
Grey Wolf
9%
Labrador
9%
Yorkshire Terrier
9%

Current Energy

Vitality -44 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail Border Collie
Legs Pug
Front Legs German Shepard
Head Grey Wolf
Ears Pug
Snout Husky
Mouth Border Collie
Nose Labrador
Eyes Husky
Color Yorkshire Terrier