Waluigi Wilber Bitcoin Game Dog - Mix of Pug, Shiba Inu, Maltese, Border Collie, Corgi, Pitbull terrier, Yorkshire Terrier and Dachshund
Waluigi Wilber
  • Purity 6%
  • Age 19 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'll outrun you for the ball if I can...that's just how I roll. Size doesn't matter, I like 'em all. I've been solitary dog...looking for someone worth changing over.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAGTATACGTAACCACCAGCTCCTTAGAAGGA
G
A
A
G
T
A
T
A
C
G
T
A
A
C
C
A
C
C
A
G
C
T
C
C
T
T
A
G
A
A
G
G
A
Genes: 2EJEKKONF2A

Composition

Pug
18%
Shiba Inu
18%
Maltese
18%
Border Collie
9%
Corgi
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
Dachshund
9%

Current Energy

Vitality -45 points
Lunar Effect -6 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Border Collie
Front Legs Shiba Inu
Head Maltese
Ears Maltese
Snout Corgi
Mouth Pitbull terrier
Nose Yorkshire Terrier
Eyes Pug
Color Dachshund

Parents

No Children

Gift