Muffin Martha Bitcoin Dog - Mix of St. Bernard, Dachshund, Maltese, French Bulldog, Border Collie, Pitbull terrier, Labrador BK, Schnauzer and German Shepard
Muffin Martha
  • Purity 8%
  • Age 11 months
  • Racing Exp 0
  • St. Bernard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Barkjour mi amor! I'm Muffin Martha. I hate being left alone all day. My bark alone scares birds out of my yard. Removing excess stuffing from pillows is my favorite hobby. My humans say I slobber too much, but hey, I'm just juicy. I'm looking for someone who is also playful, feisty and happy.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAACCCGATACTGATGATGATCCGCAATATCA
G
G
A
A
C
C
C
G
A
T
A
C
T
G
A
T
G
A
T
G
A
T
C
C
G
C
A
A
T
A
T
C
A
Genes: AK9JBBBN6C7

Composition

St. Bernard
27%
Dachshund
9%
Maltese
9%
French Bulldog
9%
Border Collie
9%
Pitbull terrier
9%
Labrador BK
9%
Schnauzer
9%
German Shepard
9%

Current Energy

Vitality -28 points
Lunar Effect +8 points

Traits Breakdown

Body Dachshund
Tail Maltese
Legs French Bulldog
Front Legs Border Collie
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth Pitbull terrier
Nose Labrador BK
Eyes Schnauzer
Color German Shepard

Parents

No Children

Gift