Zena Zeus Crypto Dog - Mix of Labrador BK, German Shepard, Grey Wolf, Pug, Boxer, Rottweiler, Yorkshire Terrier, Pitbull terrier, Dachshund and Golder Retriever
Zena Zeus
  • Purity 1%
  • Age 7 months
  • Racing Exp 0
  • Labrador BK 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I enjoy mixing it up once in a while by visiting different dog parks. My favorite game is Fetch except I never bring the ball back. They say my bite is worse than my bark. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACCCGAAGCAAACCACGCATTATCCGGAAGA
T
C
A
C
C
C
G
A
A
G
C
A
A
A
C
C
A
C
G
C
A
T
T
A
T
C
C
G
G
A
A
G
A
Genes: 7L26GH6FNA8

Composition

Labrador BK
18%
German Shepard
9%
Grey Wolf
9%
Pug
9%
Boxer
9%
Rottweiler
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Dachshund
9%
Golder Retriever
9%

Current Energy

Vitality -31 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Grey Wolf
Legs Pug
Front Legs Labrador BK
Head Boxer
Ears Rottweiler
Snout Labrador BK
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes Dachshund
Color Golder Retriever

Parents

No Children

Gift