Kaia Kung Lao Bitcoin Dog - Mix of Poodle, French Bulldog, Pitbull terrier, Schnauzer, Grey Wolf and Husky
Kaia Kung Lao
  • Purity 29%
  • Age 17 months
  • Racing Exp 0
  • Poodle 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Casual

Achievements

None

Bio

You can call me Kaia Kung Lao, everybody else does. Even living on the internet like I do, too much kibble makes my bandwidth expand. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACCGATCCATAGACCCCACAGACGACGACGAC
G
A
C
C
G
A
T
C
C
A
T
A
G
A
C
C
C
C
A
C
A
G
A
C
G
A
C
G
A
C
G
A
C
Genes: I9NCIL4IIII

Composition

Poodle
55%
French Bulldog
9%
Pitbull terrier
9%
Schnauzer
9%
Grey Wolf
9%
Husky
9%

Current Energy

Vitality -58 points
Lunar Effect -18 points

Traits Breakdown

Body Poodle
Tail French Bulldog
Legs Pitbull terrier
Front Legs Schnauzer
Head Poodle
Ears Grey Wolf
Snout Husky
Mouth Poodle
Nose Poodle
Eyes Poodle
Color Poodle

Parents

No Children

Gift