Scarlett Scarlett Bitcoin Game Dog - Mix of Corgi, St. Bernard, Beagle, Shiba Inu, Labrador BK, Schnauzer, Golder Retriever, Pitbull terrier and Maltese
Scarlett Scarlett
  • Purity 4%
  • Age 6 months
  • Racing Exp 2
  • Corgi 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

What's up, dog? I'm Scarlett Scarlett! I think hamsters and cats are both over-rated. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I'll be honest...Napping is my favorite so we gotta go slow. I'm looking for some ruff play. Wanna bite me?

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.23 sec
No rank  Racing *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total *** LTC

DNA Analysis

DNA Sequence: TGACTAAGCGTAGCAAGCATAAGATCCAGCACC
T
G
A
C
T
A
A
G
C
G
T
A
G
C
A
A
G
C
A
T
A
A
G
A
T
C
C
A
G
C
A
C
C
Genes: BDOE6OC8NOK

Composition

Corgi
27%
St. Bernard
9%
Beagle
9%
Shiba Inu
9%
Labrador BK
9%
Schnauzer
9%
Golder Retriever
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -60 points
Lunar Effect +4 points

Traits Breakdown

Body St. Bernard
Tail Beagle
Legs Corgi
Front Legs Shiba Inu
Head Labrador BK
Ears Corgi
Snout Schnauzer
Mouth Golder Retriever
Nose Pitbull terrier
Eyes Corgi
Color Maltese

Parents

No Children

Photos

Gift