Attila Allie Crypto Dog - Mix of Border Collie, Golder Retriever, Labrador, Corgi, Yorkshire Terrier, Beagle, Dachshund, Schnauzer and Rottweiler
Attila Allie
  • Purity 5%
  • Age 4 months
  • Racing Exp 7
  • Border Collie 18%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I'm into chasing fast cars, squirrels and my tail. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I'm looking for some ruff play. Wanna bite me?

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.57 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACCCAAGCTTATACAGAAGACTAGGAATACAC
T
A
C
C
C
A
A
G
C
T
T
A
T
A
C
A
G
A
A
G
A
C
T
A
G
G
A
A
T
A
C
A
C
Genes: J5OFJ88DACH

Composition

Border Collie
18%
Golder Retriever
18%
Labrador
9%
Corgi
9%
Yorkshire Terrier
9%
Beagle
9%
Dachshund
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality -29 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Labrador
Legs Corgi
Front Legs Yorkshire Terrier
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Beagle
Nose Dachshund
Eyes Schnauzer
Color Rottweiler