Chivas Cash Crypto Game Dog - Mix of French Bulldog, St. Bernard, Husky, Maltese, Grey Wolf, Dachshund, Corgi and Golder Retriever
Chivas Cash
  • Purity 6%
  • Age 11 months
  • Racing Exp 1
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I live behind a firewall in the Machine. The smell of fresh manure to roll in makes me wild. I'm into chasing fast cars, squirrels and my tail. I hate bubble baths; mud puddles are more my style. As a designer, I suggest low windows or couch backs next to windows without curtains.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.92 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAACCCGACCCGGATGAAGCACAACATGAAGA
C
G
A
A
C
C
C
G
A
C
C
C
G
G
A
T
G
A
A
G
C
A
C
A
A
C
A
T
G
A
A
G
A
Genes: 9K9LABO44B8

Composition

French Bulldog
18%
St. Bernard
18%
Husky
18%
Maltese
9%
Grey Wolf
9%
Dachshund
9%
Corgi
9%
Golder Retriever
9%

Current Energy

Vitality -25 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs French Bulldog
Front Legs Grey Wolf
Head Dachshund
Ears St. Bernard
Snout Corgi
Mouth Husky
Nose Husky
Eyes St. Bernard
Color Golder Retriever