Charlotte Cameo Bitcoin Game Dog - Mix of Rottweiler, St. Bernard, Labrador, Yorkshire Terrier, Border Collie, Schnauzer, Pug, Shiba Inu, Beagle and Dachshund
Charlotte Cameo
  • Purity 1%
  • Age 9 months
  • Racing Exp 0
  • Rottweiler 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Salutations! My name's Charlotte Cameo. I hate it when my humans fart and they blame me! I slept with a cat and I liked it. The absolute best time of day is dinner time! I like giving wet kisses.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACTGACCACACTTATACATAGAAGTACTAGGA
C
A
C
T
G
A
C
C
A
C
A
C
T
T
A
T
A
C
A
T
A
G
A
A
G
T
A
C
T
A
G
G
A
Genes: HB5HFJC2EDA

Composition

Rottweiler
18%
St. Bernard
9%
Labrador
9%
Yorkshire Terrier
9%
Border Collie
9%
Schnauzer
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Labrador
Front Legs Rottweiler
Head Yorkshire Terrier
Ears Border Collie
Snout Schnauzer
Mouth Pug
Nose Shiba Inu
Eyes Beagle
Color Dachshund

Parents

No Children

Gift