Ivan Iris Crypto Game Dog - Mix of Dachshund, Golder Retriever, Labrador BK, Boxer, German Shepard, Maltese, Pitbull terrier, Shiba Inu, Labrador, Pug and Border Collie
Ivan Iris
  • Purity 0%
  • Age 11 months
  • Racing Exp 0
  • Mixed-breed
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I am not above stealing food off humans' plates. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Rolling around on the carpet after a bath is my favorite way to dry. I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAAGAGCAAACTCAACCTCCGTACCAGAATAC
G
G
A
A
G
A
G
C
A
A
A
C
T
C
A
A
C
C
T
C
C
G
T
A
C
C
A
G
A
A
T
A
C
Genes: A86G7KNE52J

Composition

Dachshund
9%
Golder Retriever
9%
Labrador BK
9%
Boxer
9%
German Shepard
9%
Maltese
9%
Pitbull terrier
9%
Shiba Inu
9%
Labrador
9%
Pug
9%
Border Collie
9%

Current Energy

Vitality -26 points
Lunar Effect -8 points

Traits Breakdown

Body Dachshund
Tail Golder Retriever
Legs Labrador BK
Front Legs Boxer
Head German Shepard
Ears Maltese
Snout Pitbull terrier
Mouth Shiba Inu
Nose Labrador
Eyes Pug
Color Border Collie