Nickie Nyx Bitcoin Game Dog - Mix of Schnauzer, Poodle, Boxer, Rottweiler, Labrador BK, Yorkshire Terrier, French Bulldog, Beagle, Dachshund and Husky
Nickie Nyx
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Schnauzer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Are you into garbage cans? I am. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Oh, go ahead. Pet me. I know you want to.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACAACCACGCAATATTAATACGACTAGGAACA
G
A
C
A
A
C
C
A
C
G
C
A
A
T
A
T
T
A
A
T
A
C
G
A
C
T
A
G
G
A
A
C
A
Genes: IGH6CFC9DA4

Composition

Schnauzer
18%
Poodle
9%
Boxer
9%
Rottweiler
9%
Labrador BK
9%
Yorkshire Terrier
9%
French Bulldog
9%
Beagle
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality -33 points
Lunar Effect +6 points

Traits Breakdown

Body Poodle
Tail Boxer
Legs Rottweiler
Front Legs Labrador BK
Head Schnauzer
Ears Yorkshire Terrier
Snout Schnauzer
Mouth French Bulldog
Nose Beagle
Eyes Dachshund
Color Husky

Parents

No Children

Gift