Lovey Lincoln Litecoin Dog - Mix of Husky, Schnauzer, Labrador BK, Pug, Border Collie, Rottweiler, Dachshund, Shiba Inu and Boxer
Lovey Lincoln
  • Purity 5%
  • Age 15 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Tardy

Achievements

None

Bio

Let me introduce myself, I'm Lovey Lincoln. I live inside of a web app in a big data center. Oh, go ahead. Pet me. I know you want to. I like to work out by digging fresh holes in landscaped yards. My favorite game is Fetch except I never bring the ball back.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAGCAGAATACATACACATAGGAGTAAACACA
A
C
A
G
C
A
G
A
A
T
A
C
A
T
A
C
A
C
A
T
A
G
G
A
G
T
A
A
A
C
A
C
A
Genes: 462JCHCAEG4

Composition

Husky
18%
Schnauzer
18%
Labrador BK
9%
Pug
9%
Border Collie
9%
Rottweiler
9%
Dachshund
9%
Shiba Inu
9%
Boxer
9%

Current Energy

Vitality -33 points
Lunar Effect -6 points

Traits Breakdown

Body Husky
Tail Labrador BK
Legs Pug
Front Legs Border Collie
Head Schnauzer
Ears Rottweiler
Snout Schnauzer
Mouth Dachshund
Nose Shiba Inu
Eyes Boxer
Color Husky