Sassy Snuffles Digital Cryptocurrency Dog - Mix of Maltese, Yorkshire Terrier, Labrador, Golder Retriever, German Shepard, French Bulldog, Schnauzer, Poodle and St. Bernard
Sassy Snuffles
  • Purity 3%
  • Age 5 months
  • Racing Exp 0
  • Maltese 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Have you ever dated a digital creation before? Once I caught a seagull, but it scared me so I let it go. I hate being left alone all day. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I'm not looking to hook up forever, just to have a little fun.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCCCAAGATCACGAATATTAGACACCTTATGA
A
C
C
C
C
A
A
G
A
T
C
A
C
G
A
A
T
A
T
T
A
G
A
C
A
C
C
T
T
A
T
G
A
Genes: K5879CFIKFB

Composition

Maltese
18%
Yorkshire Terrier
18%
Labrador
9%
Golder Retriever
9%
German Shepard
9%
French Bulldog
9%
Schnauzer
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -39 points
Lunar Effect -2 points

Traits Breakdown

Body Maltese
Tail Labrador
Legs Golder Retriever
Front Legs German Shepard
Head French Bulldog
Ears Schnauzer
Snout Yorkshire Terrier
Mouth Poodle
Nose Maltese
Eyes Yorkshire Terrier
Color St. Bernard

Parents

No Children

Gift