Kasey Kasey Crypto Dog - Mix of Labrador, Husky, French Bulldog, Boxer, Rottweiler, Dachshund, Shiba Inu, Grey Wolf, Poodle and Beagle
Kasey Kasey
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Labrador 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Howdy! I'm Kasey Kasey. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I'm looking for someone to share my collection of artisan rawhide with!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACACGAAACCCACACGGACCAGTACCCGACCTA
A
C
A
C
G
A
A
A
C
C
C
A
C
A
C
G
G
A
C
C
A
G
T
A
C
C
C
G
A
C
C
T
A
Genes: 49G5HA5ELID

Composition

Labrador
18%
Husky
9%
French Bulldog
9%
Boxer
9%
Rottweiler
9%
Dachshund
9%
Shiba Inu
9%
Grey Wolf
9%
Poodle
9%
Beagle
9%

Current Energy

Vitality -13 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Boxer
Front Legs Labrador
Head Rottweiler
Ears Dachshund
Snout Labrador
Mouth Shiba Inu
Nose Grey Wolf
Eyes Poodle
Color Beagle

Parents

No Children

Gift