Siri Smarty Bitcoin Game Dog - Mix of St. Bernard, French Bulldog, Border Collie, Poodle, Grey Wolf, Yorkshire Terrier, Pug, Dachshund, Shiba Inu, Boxer and Golder Retriever
Siri Smarty
  • Purity 0%
  • Age 13 months
  • Racing Exp 0
  • Mixed-breed
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

Yo dog! Siri Smarty here. I hate having to wear foo-foo clothes and ribbons in my fur. I think hamsters and cats are both over-rated. Chasing anything that will run is so much fun, I could do that all day. I like it when you're frisky.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGACGATACGACCCCTTAGAAGGAGTAAACAGA
T
G
A
C
G
A
T
A
C
G
A
C
C
C
C
T
T
A
G
A
A
G
G
A
G
T
A
A
A
C
A
G
A
Genes: B9JILF2AEG8

Composition

St. Bernard
9%
French Bulldog
9%
Border Collie
9%
Poodle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Pug
9%
Dachshund
9%
Shiba Inu
9%
Boxer
9%
Golder Retriever
9%

Current Energy

Vitality -37 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail French Bulldog
Legs Border Collie
Front Legs Poodle
Head Grey Wolf
Ears Yorkshire Terrier
Snout Pug
Mouth Dachshund
Nose Shiba Inu
Eyes Boxer
Color Golder Retriever

Parents

No Children

Gift