Amy Akita Bitcoin Dog - Mix of Corgi, Golder Retriever, Pug, French Bulldog, Husky, St. Bernard, Border Collie, Maltese and Yorkshire Terrier
Amy Akita
  • Purity 3%
  • Age 5 months
  • Racing Exp 0
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! My human's feet are definitely the greatest smell ever. Especially after a long day at work! I like big butts, I cannot lie. Sometimes I forget where I buried my bone.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAACGAAGCAGAACATGAAGCTACACCAGATTA
G
A
A
C
G
A
A
G
C
A
G
A
A
C
A
T
G
A
A
G
C
T
A
C
A
C
C
A
G
A
T
T
A
Genes: 29O84BOJK8F

Composition

Corgi
18%
Golder Retriever
18%
Pug
9%
French Bulldog
9%
Husky
9%
St. Bernard
9%
Border Collie
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -34 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail French Bulldog
Legs Corgi
Front Legs Golder Retriever
Head Husky
Ears St. Bernard
Snout Corgi
Mouth Border Collie
Nose Maltese
Eyes Golder Retriever
Color Yorkshire Terrier

Parents

No Children

Gift