Zippy Zinger Crypto Game Dog - Mix of Poodle, Pug, Maltese, Golder Retriever, Labrador BK, Labrador, St. Bernard, Grey Wolf and Schnauzer
Zippy Zinger
  • Purity 3%
  • Age 15 months
  • Racing Exp 0
  • Poodle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Lazy

Achievements

None

Bio

Hey, good-looking! This is Zippy Zinger. The Ethernet where I live, rocks. I think hamsters and cats are both over-rated. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCAGAGCACCATGAGACGAACCCATAGACGAA
A
C
C
A
G
A
G
C
A
C
C
A
T
G
A
G
A
C
G
A
A
C
C
C
A
T
A
G
A
C
G
A
A
Genes: K865BI2LCI2

Composition

Poodle
18%
Pug
18%
Maltese
9%
Golder Retriever
9%
Labrador BK
9%
Labrador
9%
St. Bernard
9%
Grey Wolf
9%
Schnauzer
9%

Current Energy

Vitality -31 points
Lunar Effect -2 points

Traits Breakdown

Body Maltese
Tail Golder Retriever
Legs Labrador BK
Front Legs Labrador
Head St. Bernard
Ears Poodle
Snout Pug
Mouth Grey Wolf
Nose Schnauzer
Eyes Poodle
Color Pug

Parents

No Children

Gift