Nutmeg Nike Litecoin Game Dog - Mix of Golder Retriever, Yorkshire Terrier, German Shepard, Labrador BK, Boxer, Pitbull terrier and Dachshund
Nutmeg Nike
  • Purity 9%
  • Age 11 months
  • Racing Exp 0
  • Golder Retriever 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! The place I like most in the world is curled up in my human's bed, hogging all the covers! Aggressive dogs that don't let 'me be me' frustrate me. Looking for that special tail wag.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTATCATTATCAGCAAACAGATCCAGAAGAGGA
T
T
A
T
C
A
T
T
A
T
C
A
G
C
A
A
A
C
A
G
A
T
C
C
A
G
A
A
G
A
G
G
A
Genes: F7F76G8N88A

Composition

Golder Retriever
27%
Yorkshire Terrier
18%
German Shepard
18%
Labrador BK
9%
Boxer
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -37 points
Lunar Effect -12 points

Traits Breakdown

Body Yorkshire Terrier
Tail German Shepard
Legs Yorkshire Terrier
Front Legs German Shepard
Head Labrador BK
Ears Boxer
Snout Golder Retriever
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Golder Retriever
Color Dachshund

Parents

No Children

Gift