Meeko Moon Digital Cryptocurrency Dog - Mix of Maltese, German Shepard, Shiba Inu, Husky, Pitbull terrier, Dachshund, Corgi, Schnauzer, Golder Retriever, Labrador and Grey Wolf
Meeko Moon
  • Purity 0%
  • Age 7 months
  • Racing Exp 0
  • Mixed-breed
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hello, there. Meeko Moon here. I'd like to take you for a byte to eat in cyberspace. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! Air Bud is definitely my favorite movie. What a role model! I've had my nose rubbed in 'it' more than once.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCTCAGTAACATCCGGAAGCATAAGACCACCC
A
C
C
T
C
A
G
T
A
A
C
A
T
C
C
G
G
A
A
G
C
A
T
A
A
G
A
C
C
A
C
C
C
Genes: K7E4NAOC85L

Composition

Maltese
9%
German Shepard
9%
Shiba Inu
9%
Husky
9%
Pitbull terrier
9%
Dachshund
9%
Corgi
9%
Schnauzer
9%
Golder Retriever
9%
Labrador
9%
Grey Wolf
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail German Shepard
Legs Shiba Inu
Front Legs Husky
Head Pitbull terrier
Ears Dachshund
Snout Corgi
Mouth Schnauzer
Nose Golder Retriever
Eyes Labrador
Color Grey Wolf

Parents

No Children

Gift