Bilbo Breeze Crypto Dog - Mix of Husky, German Shepard, Grey Wolf, Rottweiler, French Bulldog, Corgi, Schnauzer, Poodle and Maltese
Bilbo Breeze
  • Purity 5%
  • Age 13 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

I've been known to take mega bytes when playing ruff. Halloween costumes are the worst, I hate 'em! I love fetching anything my human throws! My favorite place in the world is the dog park. So many smells! If you are looking for a pooch who's in touch with feelings, here I am.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATCACCCTCACACCGAAGCATAGACACCACA
A
C
A
T
C
A
C
C
C
T
C
A
C
A
C
C
G
A
A
G
C
A
T
A
G
A
C
A
C
C
A
C
A
Genes: 47L7H9OCIK4

Composition

Husky
18%
German Shepard
18%
Grey Wolf
9%
Rottweiler
9%
French Bulldog
9%
Corgi
9%
Schnauzer
9%
Poodle
9%
Maltese
9%

Current Energy

Vitality -11 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Grey Wolf
Front Legs German Shepard
Head Rottweiler
Ears French Bulldog
Snout Corgi
Mouth Schnauzer
Nose Poodle
Eyes Maltese
Color Husky

Parents

No Children

Gift