Skitty Snickers Bitcoin Game Dog - Mix of Schnauzer, Corgi, Yorkshire Terrier, Poodle, Boxer, Grey Wolf, St. Bernard and Pug
Skitty Snickers
  • Purity 8%
  • Age 4 months
  • Racing Exp 1
  • Schnauzer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hi! My name is Skitty Snickers. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I'm hoping to find someone that doesn't mind the occasional gas after dinner!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.37 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACAACCCCATATGAGAAAGCAGCTTATTAATA
G
A
C
A
A
C
C
C
C
A
T
A
T
G
A
G
A
A
A
G
C
A
G
C
T
T
A
T
T
A
A
T
A
Genes: IGLCB2OOFFC

Composition

Schnauzer
18%
Corgi
18%
Yorkshire Terrier
18%
Poodle
9%
Boxer
9%
Grey Wolf
9%
St. Bernard
9%
Pug
9%

Current Energy

Vitality -32 points
Lunar Effect +2 points

Traits Breakdown

Body Poodle
Tail Boxer
Legs Grey Wolf
Front Legs Schnauzer
Head St. Bernard
Ears Pug
Snout Corgi
Mouth Corgi
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Schnauzer