Dee Dee Desoto Virtual Crypto Dog - Mix of Pug, French Bulldog, Shiba Inu, Labrador BK, Pitbull terrier, Beagle, Maltese, German Shepard, Corgi and Border Collie
Dee Dee Desoto
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Howdy there. I'm Dee Dee Desoto. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! They say my bite is worse than my bark. My turn-offs are rolled up newspapers and loud noises. New experiences? New treats? New places! Yes, please!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAGTAGAAGCATCCGAACTAACCTCAAGCTAC
C
G
A
G
T
A
G
A
A
G
C
A
T
C
C
G
A
A
C
T
A
A
C
C
T
C
A
A
G
C
T
A
C
Genes: 9E26N2DK7OJ

Composition

Pug
18%
French Bulldog
9%
Shiba Inu
9%
Labrador BK
9%
Pitbull terrier
9%
Beagle
9%
Maltese
9%
German Shepard
9%
Corgi
9%
Border Collie
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Shiba Inu
Legs Pug
Front Legs Labrador BK
Head Pitbull terrier
Ears Pug
Snout Beagle
Mouth Maltese
Nose German Shepard
Eyes Corgi
Color Border Collie

Parents

No Children

Gift