Dandy Deuce Bitcoin Dog - Mix of Yorkshire Terrier, Corgi, Husky, St. Bernard, Schnauzer, Golder Retriever, Labrador, Poodle and French Bulldog
Dandy Deuce
  • Purity 3%
  • Age 11 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

This dawg chases mice in a big data warehouse. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! Spiked dog collars really turn me on.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATTATGAAGCATATTAAGCAGACCAGACCGA
A
C
A
T
T
A
T
G
A
A
G
C
A
T
A
T
T
A
A
G
C
A
G
A
C
C
A
G
A
C
C
G
A
Genes: 4FBOCFO85I9

Composition

Yorkshire Terrier
18%
Corgi
18%
Husky
9%
St. Bernard
9%
Schnauzer
9%
Golder Retriever
9%
Labrador
9%
Poodle
9%
French Bulldog
9%

Current Energy

Vitality -40 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Corgi
Head Schnauzer
Ears Yorkshire Terrier
Snout Corgi
Mouth Golder Retriever
Nose Labrador
Eyes Poodle
Color French Bulldog