Satan's Dog Bitcoin Game Dog - Mix of Beagle, Boxer, German Shepard, French Bulldog, Schnauzer, Labrador, Corgi, Grey Wolf and Rottweiler
Satan's Dog
  • Purity 5%
  • Age 6 months
  • Racing Exp 0
  • Beagle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I live in your digital dreams. I think hamsters and cats are both over-rated. After introductory sniffing, I like some licking. I hate having to share my food dish... I absolutely love long walks when I can stop and smell the bushes.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACTACGAATACTACCAAGCCCCAACAACCAC
T
C
A
C
T
A
C
G
A
A
T
A
C
T
A
C
C
A
A
G
C
C
C
C
A
A
C
A
A
C
C
A
C
Genes: 7D9CD5OLGGH

Composition

Beagle
18%
Boxer
18%
German Shepard
9%
French Bulldog
9%
Schnauzer
9%
Labrador
9%
Corgi
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality -43 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs French Bulldog
Front Legs Schnauzer
Head Beagle
Ears Labrador
Snout Corgi
Mouth Grey Wolf
Nose Boxer
Eyes Boxer
Color Rottweiler

Parents

No Children

Gift