Gage Goober Crypto Dog - Mix of Pug, Dachshund, Yorkshire Terrier, Golder Retriever, Shiba Inu, Border Collie, St. Bernard, Beagle, Labrador and Rottweiler
Gage Goober
  • Purity 1%
  • Age 9 months
  • Racing Exp 23
  • Pug 18%
  • Gold medal 1 Silver medal 0 Bronze medal 2
  • 6 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Howdy! I'm Gage Goober. I am a proud show dog. I like showing off my perfect coat! What's your favorite bed? Mine is the dirty laundry. Halloween costumes are the worst, I hate 'em! Oh, go ahead. Pet me. I know you want to.

Racing Stats

Ran 6 races
  • 1 0 2
 Best Time15.05 sec
Rank 46  RacingĀ *** LTC
50.0 % wins (3) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGATTAGAAAGAGAAGTATACTGACTACCACAC
G
G
A
T
T
A
G
A
A
A
G
A
G
A
A
G
T
A
T
A
C
T
G
A
C
T
A
C
C
A
C
A
C
Genes: AF282EJBD5H

Composition

Pug
18%
Dachshund
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Shiba Inu
9%
Border Collie
9%
St. Bernard
9%
Beagle
9%
Labrador
9%
Rottweiler
9%

Current Energy

Vitality -47 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Pug
Front Legs Golder Retriever
Head Pug
Ears Shiba Inu
Snout Border Collie
Mouth St. Bernard
Nose Beagle
Eyes Labrador
Color Rottweiler

Parents

No Children

Photos

Litecoin canine race podium Bitcoin doggy race photo online doggy racing
Gift