Sagat Scoobie Bitcoin Dog - Mix of Shiba Inu, Labrador BK, Pitbull terrier, Dachshund, Yorkshire Terrier, Poodle, German Shepard and Boxer
Sagat Scoobie
  • Purity 6%
  • Age 50 days
  • Racing Exp 0
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Slothful

Achievements

None

Bio

My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Forget plastic hotdogs...I'm into the classic chew toys like slippers. I have a crush on the Grumpy cat.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAGTATTAGCATCCTCCGACTCAAACGCAGTA
G
G
A
G
T
A
T
T
A
G
C
A
T
C
C
T
C
C
G
A
C
T
C
A
A
A
C
G
C
A
G
T
A
Genes: AEF6NNI7G6E

Composition

Shiba Inu
18%
Labrador BK
18%
Pitbull terrier
18%
Dachshund
9%
Yorkshire Terrier
9%
Poodle
9%
German Shepard
9%
Boxer
9%

Current Energy

Vitality +7 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Shiba Inu
Legs Yorkshire Terrier
Front Legs Labrador BK
Head Pitbull terrier
Ears Pitbull terrier
Snout Poodle
Mouth German Shepard
Nose Boxer
Eyes Labrador BK
Color Shiba Inu

Parents

No Children

Gift