Clifford Chico Crypto Game Dog - Mix of French Bulldog, Dachshund, Pitbull terrier, Labrador BK, Shiba Inu, Schnauzer, Husky, Beagle and Boxer
Clifford Chico
  • Purity 5%
  • Age 50 days
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Slothful

Achievements

None

Bio

Hey! Call me Clifford Chico. I live in your digital dreams. Air Bud is definitely my favorite movie. What a role model! I'm not into dog collars, unless you're into S & M. I'm willing to try little bondage, so my human chained me up! I enjoy finding and eating frozen cat turds in the winter. Bon appétit!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  Racing *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total *** LTC

DNA Analysis

DNA Sequence: CGACGATCCGCAGTAATAACACTAGGAAACGGA
C
G
A
C
G
A
T
C
C
G
C
A
G
T
A
A
T
A
A
C
A
C
T
A
G
G
A
A
A
C
G
G
A
Genes: 99N6EC4DAGA

Composition

French Bulldog
18%
Dachshund
18%
Pitbull terrier
9%
Labrador BK
9%
Shiba Inu
9%
Schnauzer
9%
Husky
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality +12 points
Lunar Effect +8 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs Pitbull terrier
Front Legs Labrador BK
Head Shiba Inu
Ears Schnauzer
Snout Husky
Mouth Beagle
Nose Dachshund
Eyes Boxer
Color Dachshund

Parents

No Children

Gift