Verona Volvo Digital Cryptocurrency Dog - Mix of Labrador, Rottweiler, German Shepard, Corgi, Husky, Maltese, Yorkshire Terrier, French Bulldog and Shiba Inu
Verona Volvo
  • Purity 5%
  • Age 13 months
  • Racing Exp 117
  • Labrador 18%
  • Gold medal 7 Silver medal 3 Bronze medal 5
  • 25 races
  • Gen 0
Sad & Tardy

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 25 races
  • 7 3 5
 Best Time14.18 sec
Rank 20  RacingĀ *** LTC
60.0 % wins (15) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAAGCACACCAACCCACCACCCATTACGAGTA
T
C
A
A
G
C
A
C
A
C
C
A
A
C
C
C
A
C
C
A
C
C
C
A
T
T
A
C
G
A
G
T
A
Genes: 7O45KHH5F9E

Composition

Labrador
18%
Rottweiler
18%
German Shepard
9%
Corgi
9%
Husky
9%
Maltese
9%
Yorkshire Terrier
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality -11 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Husky
Front Legs Labrador
Head Maltese
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Yorkshire Terrier
Eyes French Bulldog
Color Shiba Inu