Shaggy Sofia Litecoin Dog - Mix of Shiba Inu, Corgi, German Shepard, Yorkshire Terrier, Border Collie, Golder Retriever and Dachshund
Shaggy Sofia
  • Purity 11%
  • Age 52 days
  • Racing Exp 0
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Snaillike

Achievements

None

Bio

I live in cyberspace where you can turn me on. Squeaky toys are the best, don't you agree? I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATTATACAGAAGCGGAGTATCATCAAGCGTA
G
T
A
T
T
A
T
A
C
A
G
A
A
G
C
G
G
A
G
T
A
T
C
A
T
C
A
A
G
C
G
T
A
Genes: EFJ8OAE77OE

Composition

Shiba Inu
27%
Corgi
18%
German Shepard
18%
Yorkshire Terrier
9%
Border Collie
9%
Golder Retriever
9%
Dachshund
9%

Current Energy

Vitality +16 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs Border Collie
Front Legs Golder Retriever
Head Corgi
Ears Dachshund
Snout Shiba Inu
Mouth German Shepard
Nose German Shepard
Eyes Corgi
Color Shiba Inu