Chaz Champ Digital Cryptocurrency Dog - Mix of Grey Wolf, German Shepard, Golder Retriever, Schnauzer, Border Collie, Labrador, Pitbull terrier and Husky
Chaz Champ
  • Purity 4%
  • Age 42 days
  • Racing Exp 0
  • Grey Wolf 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Slothful

Achievements

None

Bio

Hey there! Baby, call me Chaz Champ. They say my bite is worse than my bark. I enjoy mixing it up once in a while by visiting different dog parks. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCATATACCCATCATCCAGATCACCCACAAGA
C
C
C
A
T
A
T
A
C
C
C
A
T
C
A
T
C
C
A
G
A
T
C
A
C
C
C
A
C
A
A
G
A
Genes: LCJ57N87L48

Composition

Grey Wolf
18%
German Shepard
18%
Golder Retriever
18%
Schnauzer
9%
Border Collie
9%
Labrador
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality +60 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Schnauzer
Legs Border Collie
Front Legs Labrador
Head German Shepard
Ears Pitbull terrier
Snout Golder Retriever
Mouth German Shepard
Nose Grey Wolf
Eyes Husky
Color Golder Retriever

Parents

No Children

Gift