Suzy Simone Crypto Dog - Mix of Grey Wolf, Husky, German Shepard, Golder Retriever, Yorkshire Terrier, Poodle, Corgi and Rottweiler
Suzy Simone
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Grey Wolf 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Power outages and computer viruses scare me! I never met a leg I didn't want to hump. My human says I'm loyal, intelligent, devoted and affectionate. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I 'm here for something RUFF ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACCCCCCAGATTAGACCCCACAAGCCACACA
T
C
A
C
C
C
C
C
C
A
G
A
T
T
A
G
A
C
C
C
C
A
C
A
A
G
C
C
A
C
A
C
A
Genes: 7LL8FIL4OH4

Composition

Grey Wolf
27%
Husky
18%
German Shepard
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Poodle
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality -15 points
Lunar Effect -16 points

Traits Breakdown

Body German Shepard
Tail Grey Wolf
Legs Grey Wolf
Front Legs Golder Retriever
Head Yorkshire Terrier
Ears Poodle
Snout Grey Wolf
Mouth Husky
Nose Corgi
Eyes Rottweiler
Color Husky

Parents

No Children

Gift