Ruby Red Flag Bitcoin Dog - Mix of Husky, Pitbull terrier, Labrador BK, Maltese, Border Collie, Yorkshire Terrier, German Shepard, Pug and Shiba Inu
Ruby Red Flag
  • Purity 3%
  • Age 4 months
  • Racing Exp 14
  • Husky 18%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

Hi! My name is Ruby Red Flag. I'm not a bad dog, my data is just configured that way. I enjoy chasing my tail around. Slipping my collar, running off and making my humans worried? Every chance I get. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!

Racing Stats

Ran 2 races
  • 1 0 1
 Best Time15.12 sec
Rank 10  RacingĀ *** LTC
100.0 % wins (2) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAACAACCTCCACATACTTATCATCCGAAGTA
G
C
A
A
C
A
A
C
C
T
C
C
A
C
A
T
A
C
T
T
A
T
C
A
T
C
C
G
A
A
G
T
A
Genes: 64KN4JF7N2E

Composition

Husky
18%
Pitbull terrier
18%
Labrador BK
9%
Maltese
9%
Border Collie
9%
Yorkshire Terrier
9%
German Shepard
9%
Pug
9%
Shiba Inu
9%

Current Energy

Vitality -34 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Maltese
Front Legs Pitbull terrier
Head Husky
Ears Border Collie
Snout Yorkshire Terrier
Mouth German Shepard
Nose Pitbull terrier
Eyes Pug
Color Shiba Inu

Parents

No Children

Photos

online doggy racing results crypto dog racing
Gift