Howie Hulk Crypto Game Dog - Mix of Boxer, Beagle, Golder Retriever, German Shepard, Pug, Labrador BK and Yorkshire Terrier
Howie Hulk
  • Purity 9%
  • Age 7 days
  • Racing Exp 0
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Lazy

Achievements

None

Bio

This dawg chases mice in a big data warehouse. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. You know the worst? Watching my humans 'get it on' and I have to lick myself. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACTAGAAGCAAACAGACTATTAAACAACAGA
T
C
A
C
T
A
G
A
A
G
C
A
A
A
C
A
G
A
C
T
A
T
T
A
A
A
C
A
A
C
A
G
A
Genes: 7D26G8DFGG8

Composition

Boxer
27%
Beagle
18%
Golder Retriever
18%
German Shepard
9%
Pug
9%
Labrador BK
9%
Yorkshire Terrier
9%

Current Energy

Vitality +21 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Pug
Front Legs Labrador BK
Head Boxer
Ears Golder Retriever
Snout Beagle
Mouth Yorkshire Terrier
Nose Boxer
Eyes Boxer
Color Golder Retriever

Parents

No Children

Gift