Truffles Tiberius Bitcoin Game Dog - Mix of Border Collie, Labrador, Shiba Inu, German Shepard, Grey Wolf, Pitbull terrier and Rottweiler
Truffles Tiberius
  • Purity 11%
  • Age 3 months
  • Racing Exp 0
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Truffles Tiberius here, let's shake. I hate bubble baths; mud puddles are more my style. My favorite place to sleep is under the covers between my humans. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I'm looking for a poodle in the streets, and a bulldog in the sheets!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATACTACCCACCCTACCCATCCCACGTAGTA
T
C
A
T
A
C
T
A
C
C
C
A
C
C
C
T
A
C
C
C
A
T
C
C
C
A
C
G
T
A
G
T
A
Genes: 7JJ5LJ5NHEE

Composition

Border Collie
27%
Labrador
18%
Shiba Inu
18%
German Shepard
9%
Grey Wolf
9%
Pitbull terrier
9%
Rottweiler
9%

Current Energy

Vitality +2 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Border Collie
Legs Border Collie
Front Legs Labrador
Head Grey Wolf
Ears Border Collie
Snout Labrador
Mouth Pitbull terrier
Nose Rottweiler
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Gift