Alma Adele Crypto Dog - Mix of Border Collie, Husky, Pug, Labrador BK, Shiba Inu and Labrador
Alma Adele
  • Purity 13%
  • Age 4 months
  • Racing Exp 15
  • Border Collie 36%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

The Ethernet where I live, rocks. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm always up for a nice long walk around the neighborhood. Fences are just challenges...I don't let them stop me! I hate having to wear foo-foo clothes and ribbons in my fur.

Racing Stats

Ran 2 races
  • 1 1 0
 Best Time15.35 sec
Rank 23  RacingĀ *** LTC
100.0 % wins (2) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAACATACTACACATACGAAGTACCAGAATAC
G
C
A
A
C
A
T
A
C
T
A
C
A
C
A
T
A
C
G
A
A
G
T
A
C
C
A
G
A
A
T
A
C
Genes: 64JJ4J2E52J

Composition

Border Collie
36%
Husky
18%
Pug
18%
Labrador BK
9%
Shiba Inu
9%
Labrador
9%

Current Energy

Vitality -1 points
Lunar Effect +6 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Border Collie
Front Legs Border Collie
Head Husky
Ears Border Collie
Snout Pug
Mouth Shiba Inu
Nose Labrador
Eyes Pug
Color Border Collie