Liquid Snake Lacey Litecoin Dog - Mix of Border Collie, Dachshund, Pitbull terrier, Shiba Inu, Beagle and Corgi
Liquid Snake Lacey
  • Purity 12%
  • Age 40 days
  • Racing Exp 0
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Agile

Achievements

None

Bio

Well hello, beautiful. My name's Liquid Snake Lacey. I like nibbling on most everything, but I'll bite if you want me to. I believe running along the beach to catch a stick can be nearly orgasmic. I'm totally against baths! They are the worst! I've always wanted to be in commercials and be treated as the star I am!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGGAGTATCCCTATACTCCTACGGAGGAAGC
T
A
C
G
G
A
G
T
A
T
C
C
C
T
A
T
A
C
T
C
C
T
A
C
G
G
A
G
G
A
A
G
C
Genes: JAENDJNJAAO

Composition

Border Collie
27%
Dachshund
27%
Pitbull terrier
18%
Shiba Inu
9%
Beagle
9%
Corgi
9%

Current Energy

Vitality +6 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Dachshund
Legs Shiba Inu
Front Legs Pitbull terrier
Head Beagle
Ears Border Collie
Snout Pitbull terrier
Mouth Border Collie
Nose Dachshund
Eyes Dachshund
Color Corgi

Parents

No Children

Gift