Knuckles Kong Crypto Game Dog - Mix of German Shepard, Husky, Rottweiler, Border Collie, Grey Wolf, French Bulldog and Schnauzer
Knuckles Kong
  • Purity 11%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Sad & Snaillike

Achievements

None

Bio

Halloween costumes are the worst, I hate 'em! I'll eat my vomit and yours too. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! If you enjoy growling through fences as much as I do, we should get together.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACACACATACCCCTCAACACGAATAACATCA
T
C
A
C
A
C
A
C
A
T
A
C
C
C
C
T
C
A
A
C
A
C
G
A
A
T
A
A
C
A
T
C
A
Genes: 7H4JL749C47

Composition

German Shepard
27%
Husky
27%
Rottweiler
9%
Border Collie
9%
Grey Wolf
9%
French Bulldog
9%
Schnauzer
9%

Current Energy

Vitality +10 points
Lunar Effect -12 points

Traits Breakdown

Body German Shepard
Tail Rottweiler
Legs Husky
Front Legs Border Collie
Head Grey Wolf
Ears German Shepard
Snout Husky
Mouth French Bulldog
Nose Schnauzer
Eyes Husky
Color German Shepard