Bigs Berkeley Bitcoin Dog - Mix of Husky, French Bulldog, Pitbull terrier, Golder Retriever, Border Collie, Rottweiler, Dachshund and Schnauzer
Bigs Berkeley
  • Purity 4%
  • Age 48 days
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Sup? ;-) I'm Bigs Berkeley. I was born in the web cloud. I believe running along the beach to catch a stick can be nearly orgasmic. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  Racing¬†*** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total¬†*** LTC

DNA Analysis

DNA Sequence: ACAAGAACATACCACCGAGGACGATCCATATCC
A
C
A
A
G
A
A
C
A
T
A
C
C
A
C
C
G
A
G
G
A
C
G
A
T
C
C
A
T
A
T
C
C
Genes: 484JH9A9NCN

Composition

Husky
18%
French Bulldog
18%
Pitbull terrier
18%
Golder Retriever
9%
Border Collie
9%
Rottweiler
9%
Dachshund
9%
Schnauzer
9%

Current Energy

Vitality +25 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Husky
Front Legs Border Collie
Head Rottweiler
Ears French Bulldog
Snout Dachshund
Mouth French Bulldog
Nose Pitbull terrier
Eyes Schnauzer
Color Pitbull terrier

Parents

No Children

Gift