Dante Dodger Litecoin Dog - Mix of Pug, Labrador BK, Husky, French Bulldog, Corgi, Schnauzer and Border Collie
Dante Dodger
  • Purity 9%
  • Age 13 months
  • Racing Exp 0
  • Pug 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

If you'd like to get together, I'm Dante Dodger. I hate going to the vet and will do almost anything to avoid it. Slipping my collar, running off and making my humans worried? Every chance I get. I'm looking for a hard-working service animal who can keep up with me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAGAAGCAACACGAAGCATAGCAACAGAATAC
G
A
A
G
A
A
G
C
A
A
C
A
C
G
A
A
G
C
A
T
A
G
C
A
A
C
A
G
A
A
T
A
C
Genes: 22649OC642J

Composition

Pug
27%
Labrador BK
18%
Husky
18%
French Bulldog
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%

Current Energy

Vitality -38 points
Lunar Effect -12 points

Traits Breakdown

Body Pug
Tail Pug
Legs Labrador BK
Front Legs Husky
Head French Bulldog
Ears Corgi
Snout Schnauzer
Mouth Labrador BK
Nose Husky
Eyes Pug
Color Border Collie

Parents

No Children

Gift