Motaro Mary Puppins Litecoin Dog - Mix of Pug, Poodle, St. Bernard, Corgi, Schnauzer, Labrador BK, Labrador, Beagle and Border Collie
Motaro Mary Puppins
  • Purity 5%
  • Age 20 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Pleased to meet you! My name's Motaro Mary Puppins. I work in The Virtual Machine. The smell of fresh manure to roll in makes me wild. I'm always up for a nice long walk around the neighborhood. The place I like most in the world is curled up in my human's bed, hogging all the covers!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGAGAAAGCGAAATAGCAGACGACCCACTATAC
T
G
A
G
A
A
A
G
C
G
A
A
A
T
A
G
C
A
G
A
C
G
A
C
C
C
A
C
T
A
T
A
C
Genes: B2O2C6II5DJ

Composition

Pug
18%
Poodle
18%
St. Bernard
9%
Corgi
9%
Schnauzer
9%
Labrador BK
9%
Labrador
9%
Beagle
9%
Border Collie
9%

Current Energy

Vitality -70 points
Lunar Effect +2 points

Traits Breakdown

Body St. Bernard
Tail Pug
Legs Corgi
Front Legs Pug
Head Schnauzer
Ears Labrador BK
Snout Poodle
Mouth Poodle
Nose Labrador
Eyes Beagle
Color Border Collie

Parents

No Children

Gift