Travis Tessie Digital Cryptocurrency Dog - Mix of Corgi, Golder Retriever, Labrador, St. Bernard, Beagle, Border Collie, Schnauzer, Grey Wolf, Labrador BK and Husky
Travis Tessie
  • Purity 1%
  • Age 2 months
  • Racing Exp 0
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Hello there, my name is Travis Tessie. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I never knew my father. If you enjoy growling through fences as much as I do, we should get together.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGACCAAGCTGACTATACATAAGCCCCGCAACA
A
G
A
C
C
A
A
G
C
T
G
A
C
T
A
T
A
C
A
T
A
A
G
C
C
C
C
G
C
A
A
C
A
Genes: 85OBDJCOL64

Composition

Corgi
18%
Golder Retriever
9%
Labrador
9%
St. Bernard
9%
Beagle
9%
Border Collie
9%
Schnauzer
9%
Grey Wolf
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -11 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs Corgi
Front Legs St. Bernard
Head Beagle
Ears Border Collie
Snout Schnauzer
Mouth Corgi
Nose Grey Wolf
Eyes Labrador BK
Color Husky

Parents

No Children

Gift