Butterscotch Bitsy Bitcoin Dog - Mix of Yorkshire Terrier, Schnauzer, Golder Retriever, Pug, Shiba Inu, Beagle, Labrador BK and Boxer
Butterscotch Bitsy
  • Purity 9%
  • Age 17 months
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Yo! I'm Butterscotch Bitsy and I'd like to rock your world. I am a guard dog for the data warehouse. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I hate never catching that damn rabbit in my dreams.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 2 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAGAAGTACTAATAATATTATTAGCATTAAAC
A
G
A
G
A
A
G
T
A
C
T
A
A
T
A
A
T
A
T
T
A
T
T
A
G
C
A
T
T
A
A
A
C
Genes: 82EDCCFF6FG

Composition

Yorkshire Terrier
27%
Schnauzer
18%
Golder Retriever
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Labrador BK
9%
Boxer
9%

Current Energy

Vitality -47 points
Lunar Effect -14 points

Traits Breakdown

Body Golder Retriever
Tail Pug
Legs Shiba Inu
Front Legs Beagle
Head Schnauzer
Ears Schnauzer
Snout Yorkshire Terrier
Mouth Yorkshire Terrier
Nose Labrador BK
Eyes Yorkshire Terrier
Color Boxer

Parents

No Children

Gift