Brunhilda Bones Crypto Dog - Mix of Labrador BK, Golder Retriever, Boxer, Corgi, Pitbull terrier and Husky
Brunhilda Bones
  • Purity 20%
  • Age 8 months
  • Racing Exp 0
  • Labrador BK 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

As a digital dog, let me say Bob Dole did not invent the internet. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGCAGCAGCAAACAGCAGAAGATCCAGAACA
G
C
A
G
C
A
G
C
A
G
C
A
A
A
C
A
G
C
A
G
A
A
G
A
T
C
C
A
G
A
A
C
A
Genes: 6666GO88N84

Composition

Labrador BK
36%
Golder Retriever
27%
Boxer
9%
Corgi
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -14 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Boxer
Ears Corgi
Snout Golder Retriever
Mouth Golder Retriever
Nose Pitbull terrier
Eyes Golder Retriever
Color Husky