Baxter Butcher Boy Litecoin Game Dog - Mix of Golder Retriever, Border Collie, Labrador BK, Boxer, Corgi and French Bulldog
Baxter Butcher Boy
  • Purity 18%
  • Age 13 months
  • Racing Exp 0
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

What's up, pup? Name's Baxter Butcher Boy. Don't bother contacting me if you like cats. I enjoy mixing it up once in a while by visiting different dog parks. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATACGCAAGAAACAGCAGAAGACGAAGATAC
A
G
A
T
A
C
G
C
A
A
G
A
A
A
C
A
G
C
A
G
A
A
G
A
C
G
A
A
G
A
T
A
C
Genes: 8J68GO8898J

Composition

Golder Retriever
45%
Border Collie
18%
Labrador BK
9%
Boxer
9%
Corgi
9%
French Bulldog
9%

Current Energy

Vitality -19 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Labrador BK
Front Legs Golder Retriever
Head Boxer
Ears Corgi
Snout Golder Retriever
Mouth Golder Retriever
Nose French Bulldog
Eyes Golder Retriever
Color Border Collie

Parents

No Children

Gift