Plato Panther Litecoin Dog - Mix of Golder Retriever, Pitbull terrier, Labrador BK, Boxer, Corgi, French Bulldog and Border Collie
Plato Panther
  • Purity 16%
  • Age 6 months
  • Racing Exp 0
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Depressed & Snaillike

Achievements

None

Bio

When my human brushes my coat, I get frisky! Power outages and computer viruses scare me! My favorite pastime is playing tug-of-war with my human's underwear. I love connecting with my friends via pee-mail.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATCCGCAAGAAACAGCAGAAGACGAAGATAC
A
G
A
T
C
C
G
C
A
A
G
A
A
A
C
A
G
C
A
G
A
A
G
A
C
G
A
A
G
A
T
A
C
Genes: 8N68GO8898J

Composition

Golder Retriever
45%
Pitbull terrier
9%
Labrador BK
9%
Boxer
9%
Corgi
9%
French Bulldog
9%
Border Collie
9%

Current Energy

Vitality -22 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Pitbull terrier
Legs Labrador BK
Front Legs Golder Retriever
Head Boxer
Ears Corgi
Snout Golder Retriever
Mouth Golder Retriever
Nose French Bulldog
Eyes Golder Retriever
Color Border Collie