Tank Tequila Litecoin Dog - Mix of Pitbull terrier, Husky, Boxer, Border Collie, Maltese, Yorkshire Terrier, German Shepard, Labrador BK and Shiba Inu
Tank Tequila
  • Purity 5%
  • Age 7 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Hi, Tank Tequila is my name. I live behind a firewall in the Machine. I believe running along the beach to catch a stick can be nearly orgasmic. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I love it when you show a little teeth.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACTACACCTCCACAACATTATCATCCGCAGTA
A
A
C
T
A
C
A
C
C
T
C
C
A
C
A
A
C
A
T
T
A
T
C
A
T
C
C
G
C
A
G
T
A
Genes: GJKN44F7N6E

Composition

Pitbull terrier
18%
Husky
18%
Boxer
9%
Border Collie
9%
Maltese
9%
Yorkshire Terrier
9%
German Shepard
9%
Labrador BK
9%
Shiba Inu
9%

Current Energy

Vitality -47 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Border Collie
Legs Maltese
Front Legs Pitbull terrier
Head Husky
Ears Husky
Snout Yorkshire Terrier
Mouth German Shepard
Nose Pitbull terrier
Eyes Labrador BK
Color Shiba Inu

Parents

No Children

Gift