Lady Lucifer Cryptocurrency Dog - Mix of Labrador BK, Golder Retriever, German Shepard, Boxer, Dachshund, Shiba Inu, Pug and Husky
Lady Lucifer
  • Purity 9%
  • Age 7 months
  • Racing Exp 0
  • Labrador BK 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

I am a guard dog for the data warehouse. My 'G' spot is under my chin...scratch me there and I'll growl softly. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! My human is my best friend, looking for someone who is okay with that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 2 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGCATCAGCAAACGGAAGAAGAGTAGAAACA
G
C
A
G
C
A
T
C
A
G
C
A
A
A
C
G
G
A
A
G
A
A
G
A
G
T
A
G
A
A
A
C
A
Genes: 6676GA88E24

Composition

Labrador BK
27%
Golder Retriever
18%
German Shepard
9%
Boxer
9%
Dachshund
9%
Shiba Inu
9%
Pug
9%
Husky
9%

Current Energy

Vitality -8 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs German Shepard
Front Legs Labrador BK
Head Boxer
Ears Dachshund
Snout Golder Retriever
Mouth Golder Retriever
Nose Shiba Inu
Eyes Pug
Color Husky

Parents

No Children

Gift