Radar Roland - Litecoin Coin Dog
Radar Roland Bitcoin Game Dog - Mix of Labrador BK, German Shepard, Grey Wolf, Dachshund, Corgi, Yorkshire Terrier, Shiba Inu, Pug and Husky
Radar Roland
  • Purity 6%
  • Age 17 days
  • Racing Exp 0
  • Labrador BK 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Lazy

Achievements

None

Bio

Hey there! Baby, call me Radar Roland. I never met a crotch or a butt I didn't like, but I'm just friendly that way. I enjoy destroying a nice fresh pair of slippers. Hound Dog by Elvis is probably the best song ever written. I'm looking for a hard-working service animal who can keep up with me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 2 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGCATCAGCACCCGGAAGCTTAGTAGAAACA
G
C
A
G
C
A
T
C
A
G
C
A
C
C
C
G
G
A
A
G
C
T
T
A
G
T
A
G
A
A
A
C
A
Genes: 6676LAOFE24

Composition

Labrador BK
27%
German Shepard
9%
Grey Wolf
9%
Dachshund
9%
Corgi
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Pug
9%
Husky
9%

Current Energy

Vitality +57 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs German Shepard
Front Legs Labrador BK
Head Grey Wolf
Ears Dachshund
Snout Corgi
Mouth Yorkshire Terrier
Nose Shiba Inu
Eyes Pug
Color Husky