Chivas Creature Cryptocurrency Dog - Mix of Golder Retriever, Rottweiler, Border Collie, Labrador BK, Boxer, Corgi and Pitbull terrier
Chivas Creature
  • Purity 12%
  • Age 7 months
  • Racing Exp 6
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I love cuddling up, doggy-style after a romantic evening. I'm a serial monogamist. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I'm hoping to find someone who'll howl at the moon with me.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time17.12 sec
Rank 72  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 2 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATACGCACACAACAGCAGAAGATCCAGACAC
A
G
A
T
A
C
G
C
A
C
A
C
A
A
C
A
G
C
A
G
A
A
G
A
T
C
C
A
G
A
C
A
C
Genes: 8J6HGO88N8H

Composition

Golder Retriever
36%
Rottweiler
18%
Border Collie
9%
Labrador BK
9%
Boxer
9%
Corgi
9%
Pitbull terrier
9%

Current Energy

Vitality -22 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Labrador BK
Front Legs Rottweiler
Head Boxer
Ears Corgi
Snout Golder Retriever
Mouth Golder Retriever
Nose Pitbull terrier
Eyes Golder Retriever
Color Rottweiler