Slink Sable Bitcoin Dog - Mix of Labrador, Poodle, Golder Retriever, German Shepard, Maltese, Pug, Border Collie, St. Bernard and Corgi
Slink Sable
  • Purity 5%
  • Age 7 months
  • Racing Exp 7
  • Labrador 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. Air Bud is definitely my favorite movie. What a role model! It doesn't matter to me which team I play for... I just like tail. I 'm here for something RUFF ;)

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time15.92 sec
No rank  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGACCATCAGACGACCCAACCGAATACTGAAGC
A
G
A
C
C
A
T
C
A
G
A
C
G
A
C
C
C
A
A
C
C
G
A
A
T
A
C
T
G
A
A
G
C
Genes: 857II5K2JBO

Composition

Labrador
18%
Poodle
18%
Golder Retriever
9%
German Shepard
9%
Maltese
9%
Pug
9%
Border Collie
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -24 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs German Shepard
Front Legs Poodle
Head Poodle
Ears Labrador
Snout Maltese
Mouth Pug
Nose Border Collie
Eyes St. Bernard
Color Corgi

Parents

No Children

Photos

Bitcoin dog race
Gift